targeting construct Search Results


92
Addgene inc pen84 plasmid
Pen84 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/pEN84+-+CTCF-AID%5B71-114%5D-eGFP-FRT-Puro-FRT+targeting+construct+(Plasmid+%2386230)/bio_rxiv__731141-235-19-23
Average 92 stars, based on 1 article reviews
pen84 plasmid - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Addgene inc knockin targeting construct
FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram <t>of</t> <t>PBX4-FLAG</t> <t>knockin</t> (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.
Knockin Targeting Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/Human+NANOS3-P2A-mCherry+knock-in+targeting+construct+(Plasmid+%2359721)/pm38230761-196-28-32
Average 92 stars, based on 1 article reviews
knockin targeting construct - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Addgene inc pen244 ctcf aid 71 114 egfp frt blast frt
FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram <t>of</t> <t>PBX4-FLAG</t> <t>knockin</t> (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.
Pen244 Ctcf Aid 71 114 Egfp Frt Blast Frt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/pEN244+-+CTCF-AID%5B71-114%5D-eGFP-FRT-Blast-FRT+targeting+construct+(Plasmid+%2392140)/pm36482254-312-88-96
Average 93 stars, based on 1 article reviews
pen244 ctcf aid 71 114 egfp frt blast frt - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Addgene inc col1a 4f2a targeting construct
FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram <t>of</t> <t>PBX4-FLAG</t> <t>knockin</t> (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.
Col1a 4f2a Targeting Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/mCol%2E4F2A+targeting+construct+(Plasmid+%2325794)/pmc06900749-345-4-8
Average 90 stars, based on 1 article reviews
col1a 4f2a targeting construct - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Addgene inc j hanna 30
FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram <t>of</t> <t>PBX4-FLAG</t> <t>knockin</t> (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.
J Hanna 30, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/Nanog-CreER+targeting+construct+(Plasmid+%2359720)/pm37611093-466-7-10
Average 91 stars, based on 1 article reviews
j hanna 30 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

92
Addgene inc rad21 aid egfp targeting vector
a , Western Blot of CTCF and Vinculin (loading control) in CTCF-AID, CTCF-AID + auxin (2 days), and wild-type ESCs. 4 reproducible western blots were performed from different biological replicates. b , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 57 and 51 alleles was analyzed per probe pair in CTCF-AID and CTCF-AID + auxin cells, respectively. c , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs. d , Western Blot of <t>RAD21</t> and Vinculin (loading control) in wild-type ESCs, RAD21-AID and RAD21-AID + auxin (6 hours). 3 reproducible western blots were performed from different biological replicates. e , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 75 and 47 alleles was analyzed per probe pair in RAD21-AID and RAD21-AID + auxin cells, respectively. f , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs.
Rad21 Aid Egfp Targeting Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/pEN527+-+Rad21-AID%5B71-114%5D-eGFP-FRT-Blast-FRT+targeting+construct+(Plasmid+%23156452)/pmc07610512-94-24-28
Average 92 stars, based on 1 article reviews
rad21 aid egfp targeting vector - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
BIO-CAT Inc hus1 shrna lentiviral non-target control constructs
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
Hus1 Shrna Lentiviral Non Target Control Constructs, supplied by BIO-CAT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/hus1+shrna+lentiviral+non+target+control+constructs/pmc11384956-136-0-8
Average 90 stars, based on 1 article reviews
hus1 shrna lentiviral non-target control constructs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega nluc/target fusion constructs
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
Nluc/Target Fusion Constructs, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/nluc+target+fusion+constructs/pmc06634314-1205-10-16
Average 90 stars, based on 1 article reviews
nluc/target fusion constructs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CEM Corporation b7h3-targeted constrained cd3 engaging construct cx5952
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
B7h3 Targeted Constrained Cd3 Engaging Construct Cx5952, supplied by CEM Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/b7h3+targeted+constrained+cd3+engaging+construct+cx5952/us12331132-1778-39-27
Average 90 stars, based on 1 article reviews
b7h3-targeted constrained cd3 engaging construct cx5952 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BestGene Inc a chirna construct inserted with a targeting sequence cctttccgtagatggatgacacc
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
A Chirna Construct Inserted With A Targeting Sequence Cctttccgtagatggatgacacc, supplied by BestGene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/a+chirna+construct+inserted+with+a+targeting+sequence+cctttccgtagatggatgacacc/bio_rxiv__642314-197-5-22
Average 90 stars, based on 1 article reviews
a chirna construct inserted with a targeting sequence cctttccgtagatggatgacacc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
inGenious Targeting Laboratory embryonic stem cells containing the nklam targeting construct
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
Embryonic Stem Cells Containing The Nklam Targeting Construct, supplied by inGenious Targeting Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/embryonic+stem+cells+containing+the+nklam+targeting+construct/pmc06754162-77-10-2
Average 90 stars, based on 1 article reviews
embryonic stem cells containing the nklam targeting construct - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Personal Genome Diagnostics Inc genomic dna purification, library construction, exome capture, next-generation sequencing
Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) <t>HUS1</t> was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.
Genomic Dna Purification, Library Construction, Exome Capture, Next Generation Sequencing, supplied by Personal Genome Diagnostics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/targeting+construct/sample+preparation++library+construction+and+targeted+capture/pmc04970903-90-13-36
Average 90 stars, based on 1 article reviews
genomic dna purification, library construction, exome capture, next-generation sequencing - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram of PBX4-FLAG knockin (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.

Journal: Cell proliferation

Article Title: Transcription factor PBX4 regulates limb development and haematopoiesis in mice.

doi: 10.1111/cpr.13580

Figure Lengend Snippet: FIGURE 1 PBX4 is specifically expressed in mouse testis. (A) Schematic diagrams of Pbx4 gene structure and PBX4 protein domains. Blue and white rectangles indicate protein-coded exons and UTR regions, respectively. (B) Left panel: detection of Pbx4 expression by RT-PCRs in various tissues of adult mice. Right panel: quantitative RT-PCR results of Pbx4 expression in different testicular cells. eST, elongating spermatids; pacSC, pachytene spermatocytes; plpSC, preleptotene spermatocytes; rST, round spermatids; Sertoli, Sertoli cells; SG-A, type A spermatogonia; SG-B, type B spermatogonia. The expression levels are normalised by that of SG-A, n ≥3. (C) Schematic diagram of PBX4-FLAG knockin (KI) strategy. LHA: left homologous arm; RHA: right homologous arm. (D) Western blot analyses of PBX4 in multiple mouse organs using α-FLAG. * labels the absence of ACTB signal in heart and rectus femoris samples due to low expression levels. Equal amounts of total protein in all samples were loaded based on quantification using the BCA kit. (E) Immunohistochemical (IHC) staining of PBX4-FLAG in testicular sections using α-FLAG. pacSC, pachytene spermatocytes; rST, round spermatids. Scale bar, 20 μm.

Article Snippet: For PBX4-FLAG KI mice, donor DNA fragment containing the left and right homologous arms flanking the 3 FLAG coding sequence was cloned into a plasmid modified from a knockin targeting construct (#59721, addgene) and amplified in bacteria.

Techniques: Expressing, Quantitative RT-PCR, Knock-In, Western Blot, Immunohistochemical staining, Immunohistochemistry

a , Western Blot of CTCF and Vinculin (loading control) in CTCF-AID, CTCF-AID + auxin (2 days), and wild-type ESCs. 4 reproducible western blots were performed from different biological replicates. b , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 57 and 51 alleles was analyzed per probe pair in CTCF-AID and CTCF-AID + auxin cells, respectively. c , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs. d , Western Blot of RAD21 and Vinculin (loading control) in wild-type ESCs, RAD21-AID and RAD21-AID + auxin (6 hours). 3 reproducible western blots were performed from different biological replicates. e , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 75 and 47 alleles was analyzed per probe pair in RAD21-AID and RAD21-AID + auxin cells, respectively. f , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs.

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Western Blot of CTCF and Vinculin (loading control) in CTCF-AID, CTCF-AID + auxin (2 days), and wild-type ESCs. 4 reproducible western blots were performed from different biological replicates. b , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 57 and 51 alleles was analyzed per probe pair in CTCF-AID and CTCF-AID + auxin cells, respectively. c , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs. d , Western Blot of RAD21 and Vinculin (loading control) in wild-type ESCs, RAD21-AID and RAD21-AID + auxin (6 hours). 3 reproducible western blots were performed from different biological replicates. e , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 75 and 47 alleles was analyzed per probe pair in RAD21-AID and RAD21-AID + auxin cells, respectively. f , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Western Blot

a , Hi-C maps from ESCs along with probe locations, either between two adjacent TADs (probe pair 101-102a) or within a TADs (probe pair 102a-102b). b , Representative 3D-SIM images of the probes shown in a in the indicated cell types (probe pairs 101-102a/102a-102b; 52/58, 47/57, 163/130 and 54/61 alleles were analyzed in CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively). Maximum projections, scale bar: 500 nm. c , OFs and 3D distances between the centroids of the probes shown in a . Boxplots represent median, interquartile ranges and Tukey-style whiskers. n (probe pairs 101-102a/102a-102b) = 52/58, 47/57, 163/130 and 54/61 for CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. d , OFs and 3D distances between centroids measured for each probe pair in CTCF-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 51 alleles was analyzed per probe pair. e , Mean (± standard deviation “SD”) OF fold change (CTCF-AID + auxin / CTCF-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0019; * P = 0.016; two-sided t -test. f , OFs and 3D distances between centroids measured for each probe pair in RAD21-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 47 alleles was analyzed per probe pair. g , Mean (± SD) OF fold change (RAD21-AID + auxin / RAD21-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0012; two-sided t -test.

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Hi-C maps from ESCs along with probe locations, either between two adjacent TADs (probe pair 101-102a) or within a TADs (probe pair 102a-102b). b , Representative 3D-SIM images of the probes shown in a in the indicated cell types (probe pairs 101-102a/102a-102b; 52/58, 47/57, 163/130 and 54/61 alleles were analyzed in CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively). Maximum projections, scale bar: 500 nm. c , OFs and 3D distances between the centroids of the probes shown in a . Boxplots represent median, interquartile ranges and Tukey-style whiskers. n (probe pairs 101-102a/102a-102b) = 52/58, 47/57, 163/130 and 54/61 for CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. d , OFs and 3D distances between centroids measured for each probe pair in CTCF-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 51 alleles was analyzed per probe pair. e , Mean (± standard deviation “SD”) OF fold change (CTCF-AID + auxin / CTCF-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0019; * P = 0.016; two-sided t -test. f , OFs and 3D distances between centroids measured for each probe pair in RAD21-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 47 alleles was analyzed per probe pair. g , Mean (± SD) OF fold change (RAD21-AID + auxin / RAD21-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0012; two-sided t -test.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Hi-C, Standard Deviation

a , Hi-C map from ESCs along with probe location (TAD #22) and ChIP-seq tracks. b , Top: representative 3D-SIM images of the TAD shown in a (51 alleles were analyzed). White lines represent the boundaries probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. Bottom: 3D views of the segmented TADs shown above (gray mesh) and watershed segmented CNDs (colored objects). c , DAPI staining in ESC (3 nuclei were analyzed). Single z -slice, scale bars = 5 μm and 500 nm in the magnification. d , Extrapolated diameters (diameter of a circle with the same area than the segmented object) of TADs (ranging from 215 to 990 kb), of CNDs within them, and of CNDs measured with DAPI staining. Bins represent 50 nm, n = 804, 1,413 and 3,068, respectively. e , Representative 3D-SIM images of TAD #62 in ESC and ESC + TSA (94 and 74 alleles were analyzed in ESCs and ESCs + TSA, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. f , CND volumes. Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 296 and 417 CNDs was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. g , Mean (± SD) number of CNDs per TAD. A mean of 93 and 95 alleles was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. h , Model of 3D TAD folding. TADs, which form variable structures and are subdivided into smaller CNDs, favor chromatin intermingling in most cells. Their spatial segregation is further exacerbated in differentiated NPCs. Upon CTCF depletion, the cohesin complex can extrude chromatin , through TAD borders, inducing ectopic contacts between adjacent TADs and abolishing preferential intra-TAD interactions. Upon RAD21 depletion, preferential intra-TAD interactions are lost due to the absence of intermingling generated by the cohesin complex. Upon TSA-mediated histone hyper-acetylation, TADs remain spatially segregated while the structural organization of CNDs is disrupted.

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Hi-C map from ESCs along with probe location (TAD #22) and ChIP-seq tracks. b , Top: representative 3D-SIM images of the TAD shown in a (51 alleles were analyzed). White lines represent the boundaries probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. Bottom: 3D views of the segmented TADs shown above (gray mesh) and watershed segmented CNDs (colored objects). c , DAPI staining in ESC (3 nuclei were analyzed). Single z -slice, scale bars = 5 μm and 500 nm in the magnification. d , Extrapolated diameters (diameter of a circle with the same area than the segmented object) of TADs (ranging from 215 to 990 kb), of CNDs within them, and of CNDs measured with DAPI staining. Bins represent 50 nm, n = 804, 1,413 and 3,068, respectively. e , Representative 3D-SIM images of TAD #62 in ESC and ESC + TSA (94 and 74 alleles were analyzed in ESCs and ESCs + TSA, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. f , CND volumes. Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 296 and 417 CNDs was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. g , Mean (± SD) number of CNDs per TAD. A mean of 93 and 95 alleles was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. h , Model of 3D TAD folding. TADs, which form variable structures and are subdivided into smaller CNDs, favor chromatin intermingling in most cells. Their spatial segregation is further exacerbated in differentiated NPCs. Upon CTCF depletion, the cohesin complex can extrude chromatin , through TAD borders, inducing ectopic contacts between adjacent TADs and abolishing preferential intra-TAD interactions. Upon RAD21 depletion, preferential intra-TAD interactions are lost due to the absence of intermingling generated by the cohesin complex. Upon TSA-mediated histone hyper-acetylation, TADs remain spatially segregated while the structural organization of CNDs is disrupted.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Hi-C, ChIP-sequencing, Staining, Generated

a , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges, and Tukey-style whiskers. A mean of 84 and 64 alleles was analyzed per probe in CTCF-AID and CTCF-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. b , 3D-SIM images of TAD #62 (59 and 41 alleles were analyzed in CTCF-AID and CTCF-AID + auxin, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. c , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 176 and 116 alleles was analyzed per probe in in RAD21-AID and RAD21-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. d , 3D-SIM images of TAD #112 showing alleles segmented as one (top) or two (bottom) objects. Lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. e , Cell cycle profiling using DAPI staining (with examples of nucleus segmentation, scale bar = 10 μm). As nucleus size and DAPI intensity reflect cell cycle stage , cutoff values for nucleus area and DAPI integrated intensity were applied to define G1 ESCs. 27% of the population was defined as G1, consistently with flow cytometry measurements . 164 nuclei were analyzed. f , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. n = 48, 77 and 48 for ESC-G1, RAD21-AID + auxin and RAD21-AID + auxin single chromatids, respectively; ***, P < 0.001; two-sided Wilcoxon rank sum tests.

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges, and Tukey-style whiskers. A mean of 84 and 64 alleles was analyzed per probe in CTCF-AID and CTCF-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. b , 3D-SIM images of TAD #62 (59 and 41 alleles were analyzed in CTCF-AID and CTCF-AID + auxin, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. c , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 176 and 116 alleles was analyzed per probe in in RAD21-AID and RAD21-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. d , 3D-SIM images of TAD #112 showing alleles segmented as one (top) or two (bottom) objects. Lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. e , Cell cycle profiling using DAPI staining (with examples of nucleus segmentation, scale bar = 10 μm). As nucleus size and DAPI intensity reflect cell cycle stage , cutoff values for nucleus area and DAPI integrated intensity were applied to define G1 ESCs. 27% of the population was defined as G1, consistently with flow cytometry measurements . 164 nuclei were analyzed. f , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. n = 48, 77 and 48 for ESC-G1, RAD21-AID + auxin and RAD21-AID + auxin single chromatids, respectively; ***, P < 0.001; two-sided Wilcoxon rank sum tests.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Staining, Flow Cytometry

Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) HUS1 was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.

Journal: Cell Reports Medicine

Article Title: Myeloid cells coordinately induce glioma cell-intrinsic and cell-extrinsic pathways for chemoresistance via GP130 signaling

doi: 10.1016/j.xcrm.2024.101658

Figure Lengend Snippet: Humanin-induced chemoresistance requires ATR signaling (A) hGBM1 cells were stimulated with HN or vehicle (Ctrl.), underwent transcriptomics, and differentially expressed genes (DEGs) were analyzed by bioinformatics. (B) Experiments described in (A) were repeated with hGBM-1, 2, and 3 cells providing 12 consistent DEGs, of which several components assembled in a network. (C) HUS1 was associated with outcome in human GBMs. (D) In a myeloid-free brain sample, hGBMs have a basal level of HUS1 expression, which is upregulated by interaction with hiPSC microglia in a GP130-dependent manner. (E and F) Contribution of the ATR pathway to humanin-induced GBM expansion (E) and chemoresistance (F) was demonstrated with the ATR inhibitor AZ20. (G) Western blots showing expression levels of HUS1, ATR and beta-actin (loading control) and a readout for of ATR activation (pT1989) in hGBM1 cells treated with bovine serum albumin (control), TMZ, HN, or AZ20. (H) In summary, AZ20 does not cooperate with TMZ per se, but blocks HN-induced TMZ resistance. The number of biological replicates is indicated (dots in graphs indicate data from individual experiments); all error bars are presented as mean ± SDM. Statistical significance is shown as FDR in (A), one-way ANOVA (D, E), or two-way ANOVA (F): ∗ p < 0.05; ∗∗∗ p < 0.001; ∗∗∗∗ p < 0.0001; NS, not significant.

Article Snippet: HUS1 shRNA lentiviral and non-target control constructs , BioCat , Cat#: TLHSU1400-3364-pZIP-hCMV-ZsGreen-GVO-TRI.

Techniques: Expressing, Western Blot, Control, Activation Assay

Humanin-induced chemoresistance can be blocked therapeutically (A) Tumor size of orthotopic HN-WT or HN-C8a tumors was compared in mice receiving TMZ or vehicle (in animals with established tumor growth, 5x per week for 2 weeks; pre-defined endpoint was at 3 weeks). (B) Orthotopic hGBM1 was infused with HN (100 nM) or vehicle (artificial cerebrospinal fluid, aCSF) and i.p. injected with bazedoxifene-A (5 injections of BZA per week; 40 mg/kg; for 2 weeks) or vehicle; brains were labeled for HUS1; HUS1 expression was quantified. (C) Mice with established, orthotopic HN-WT tumors received TMZ (50 mg/kg) and were cotreated with vehicle or BZA (as in B); after 3 weeks, tumor size was quantified (dashed line: average data from untreated WT GBMs). (D) Mice with HN-WT GBMs received TMZ and were cotreated with vehicle or BZA (as in C); GBM samples were immunostained for active caspase-3 and immunolabeling was quantified (dashed line: average data from untreated WT GBMs). (E) Intratumoral vascularization and vessel diameter were compared in HN-WT or HN-C8a tumors receiving TMZ. (F) The HN-WT GBM mouse model was i.p. injected with TMZ and cotreated either with BZA or vehicle and the extent of intratumoral vascularization was compared. The number of biological replicates is indicated (dots in graphs indicate data from individual mice); all error bars are presented as mean ± SDM. Statistical significance is shown by one-way ANOVA (A, E), two-way ANOVA (B–D), or t test (F): ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; NS, not significant. Scale bars in (B, C) indicate 1 mm; scales in (D) represent 500 (overview) or 10 μm (magnified).

Journal: Cell Reports Medicine

Article Title: Myeloid cells coordinately induce glioma cell-intrinsic and cell-extrinsic pathways for chemoresistance via GP130 signaling

doi: 10.1016/j.xcrm.2024.101658

Figure Lengend Snippet: Humanin-induced chemoresistance can be blocked therapeutically (A) Tumor size of orthotopic HN-WT or HN-C8a tumors was compared in mice receiving TMZ or vehicle (in animals with established tumor growth, 5x per week for 2 weeks; pre-defined endpoint was at 3 weeks). (B) Orthotopic hGBM1 was infused with HN (100 nM) or vehicle (artificial cerebrospinal fluid, aCSF) and i.p. injected with bazedoxifene-A (5 injections of BZA per week; 40 mg/kg; for 2 weeks) or vehicle; brains were labeled for HUS1; HUS1 expression was quantified. (C) Mice with established, orthotopic HN-WT tumors received TMZ (50 mg/kg) and were cotreated with vehicle or BZA (as in B); after 3 weeks, tumor size was quantified (dashed line: average data from untreated WT GBMs). (D) Mice with HN-WT GBMs received TMZ and were cotreated with vehicle or BZA (as in C); GBM samples were immunostained for active caspase-3 and immunolabeling was quantified (dashed line: average data from untreated WT GBMs). (E) Intratumoral vascularization and vessel diameter were compared in HN-WT or HN-C8a tumors receiving TMZ. (F) The HN-WT GBM mouse model was i.p. injected with TMZ and cotreated either with BZA or vehicle and the extent of intratumoral vascularization was compared. The number of biological replicates is indicated (dots in graphs indicate data from individual mice); all error bars are presented as mean ± SDM. Statistical significance is shown by one-way ANOVA (A, E), two-way ANOVA (B–D), or t test (F): ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; NS, not significant. Scale bars in (B, C) indicate 1 mm; scales in (D) represent 500 (overview) or 10 μm (magnified).

Article Snippet: HUS1 shRNA lentiviral and non-target control constructs , BioCat , Cat#: TLHSU1400-3364-pZIP-hCMV-ZsGreen-GVO-TRI.

Techniques: Injection, Labeling, Expressing, Immunolabeling

Journal: Cell Reports Medicine

Article Title: Myeloid cells coordinately induce glioma cell-intrinsic and cell-extrinsic pathways for chemoresistance via GP130 signaling

doi: 10.1016/j.xcrm.2024.101658

Figure Lengend Snippet:

Article Snippet: HUS1 shRNA lentiviral and non-target control constructs , BioCat , Cat#: TLHSU1400-3364-pZIP-hCMV-ZsGreen-GVO-TRI.

Techniques: Plasmid Preparation, Recombinant, Transfection, Fluorescence, Staining, Reverse Transcription, Expressing, Liposomes, Mutagenesis, shRNA, Control, Construct, Software, Imaging, Functional Assay, Dissection, Sequencing, Real-time Polymerase Chain Reaction